package jannovar.annotation; import java.io.File; import java.io.FileOutputStream; import java.io.IOException; import java.io.PrintStream; import java.util.ArrayList; import java.util.HashMap; /* serialization */ import java.io.ObjectInputStream; import java.io.FileInputStream; import java.io.IOException; import jannovar.exception.JannovarException; import jannovar.io.SerializationManager; import jannovar.io.UCSCKGParser; import jannovar.common.Constants; import jannovar.common.VariantType; import jannovar.reference.TranscriptModel; import jannovar.reference.Chromosome; import jannovar.annotation.Annotation; import jannovar.annotation.AnnotationList; import jannovar.exome.Variant; import jannovar.exception.AnnotationException; import org.junit.Test; import org.junit.AfterClass; import org.junit.BeforeClass; import org.junit.Assert; /** * This class is intended to perform unuit testing on variants that * are intergenic. */ public class DeletionAnnotationTest implements Constants { private static HashMap<Byte,Chromosome> chromosomeMap = null; @SuppressWarnings (value="unchecked") @BeforeClass public static void setUp() throws IOException, JannovarException { ArrayList<TranscriptModel> kgList=null; java.net.URL url = SynonymousAnnotationTest.class.getResource(UCSCserializationTestFileName); String path = url.getPath(); SerializationManager manager = new SerializationManager(); kgList = manager.deserializeKnownGeneList(path); chromosomeMap = Chromosome.constructChromosomeMapWithIntervalTree(kgList); } @AfterClass public static void releaseResources() { chromosomeMap = null; System.gc(); } /** *<P> * annovar: MST1P9:uc010ock.2:exon2:c.117_121del:p.39_41del * The protein annotations are not accurate. * chr1:17087544GCTGT>- * The deletion goes from 17,087,544-17,087,548, on the rc it is ACAGC * The gene is on the minus strand * the deletion affects 3 codons. * GTG-CTG-TAG * Or reverse-complement * CTA-CAG-CAC: the deletion A-CAG-C * the deletion thus does not change the first amino acid, (CT*****A->CTA=Leu) * Leu-Gln-His (i.e., LQH) * The mutation changes TELQHLL -> TELPAT, * i.e., the Q at position 40 is changed to a P followed by frameshift. * NM_001271733.1:c.117_121del * Mutalzyer: * NM_001271733.1(MST1L_v001):c.119_123del * NM_001271733.1(MST1L_i001):p.(Gln40Profs*18) * Thus, we want p.Q40Pfs *</P> */ @Test public void testFSDeletionVar2() throws AnnotationException, JannovarException { byte chr = 1; int pos = 17087544; String ref = "GCTGT"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("MST1L(uc010ock.3:exon2:c.117_121del:p.Q40Pfs)",annot); } } /** *<P> * annovar: OR14A16:uc001idm.1:exon1:c.486_488del:p.162_163del, * chr1:247978544GAG>- *</P> */ @Test public void testFSDeletionVar4() throws AnnotationException, JannovarException { byte chr = 1; int pos = 247978544; String ref = "GAG"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("OR14A16(uc001idm.1:exon1:c.486_488del:p.162_163del)",annot); } } ///** // *<P> // * annovar: SRGAP2:uc009xbt.3:exon7:c.816delT:p.I272fs,SRGAP2:uc001hdy.3:exon7:c.1047delT:p.I349fs,SRGAP2:uc010prv.1:exon6:c.819delT:p.I273fs,SRGAP2:uc010pru.2:exon7:c.1044delT:p.I348fs,SRGAP2:uc001hdx.3:exon7:c.1047delT:p.I349fs,SRGAP2:uc010prt.1:exon7:c.816delT:p.I272fs, // * chr1:206579885T>- // *</P> // --- Works in principle, some of the UCSC transcripts have divergent nucleotides. //@Test public void testFSDeletionVar3() throws AnnotationException { // byte chr = 1; // int pos = 206579885; // String ref = "T"; // String alt = "-"; // Chromosome c = chromosomeMap.get(chr); // if (c==null) { // Assert.fail("Could not identify chromosome \"" + chr + "\""); // } else { // AnnotationList ann =c.getAnnotationList(pos,ref,alt); // byte varType = ann.getVarType(); // Assert.assertEquals(FS_DELETION,varType); // String annot = ann.getVariantAnnotation(); // Assert.assertEquals("SRGAP2(uc010prt.1:exon7:c.816delT:p.I272fs,uc009xbt.3:exon7:c.816delT:p.I272fs,uc010prv.1:exon6:c.819delT:p.I273fs,uc010pru.2:exon7:c.1044delT:p.I348fs,uc001hdy.3:exon7:c.1047delT:p.I349fs,uc001hdx.3:exon7:c.1047delT:p.I349fs)",annot); // } //} //*/ /** *<P> * annovar: ZNF852:uc011azx.2:exon4:c.1472_1473del:p.491_491del, * Annovar is inaccurate here. * chr3:44540796TC>- * wt: GGAGAAAAACCTTATGAATGTATTGAGT * mt: GGAAAAACCTTATGAATGTATTGAGT * wt: GEKNLMNVLS * mt: GEKPYECIE * Thus, p.N494Pfs *</P> */ @Test public void testFSDeletionVar6() throws AnnotationException, JannovarException { byte chr = 3; int pos = 44540796; String ref = "TC"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("ZNF852(uc011azx.2:exon4:c.1472_1473del:p.N494Pfs)",annot); } } /** *<P> * annovar: OR5H6:uc003dsi.1:exon1:c.369_377del:p.123_126del, * chr3:97983497TGTAACCAC>- *</P> */ @Test public void testFSDeletionVar8() throws AnnotationException , JannovarException { byte chr = 3; int pos = 97983497; String ref = "TGTAACCAC"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("OR5H6(uc003dsi.1:exon1:c.369_377del:p.123_126del)",annot); } } /** *<P> * annovar: OR5K2:uc011bgx.2:exon1:c.275_285del:p.92_95del (wrong) * chr3:98216799TTTCCCTCTAT>- * Mutalzyer: * NM_001004737.1(OR5K2_v001):c.275_285del * NM_001004737.1(OR5K2_i001):p.(Ile92Argfs*26) * Thus p.I92Rfs *</P> */ @Test public void testFSDeletionVar9() throws AnnotationException , JannovarException { byte chr = 3; int pos = 98216799; String ref = "TTTCCCTCTAT"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("OR5K2(uc011bgx.2:exon1:c.275_285del:p.I92Rfs)",annot); } } /** *<P> * annovar: PCDHA7:uc003lhq.2:exon1:c.1503_1507del:p.501_503del,PCDHA7:uc011dac.2:exon1:c.1503_1507del:p.501_503del, * chr5:140215471GCGCG>- * Thus = NM_031852.1:c.1503_1507del * Mutalyzer: * NM_031852.1(PCDHA7_v001):c.1503_1507del * NM_031852.1(PCDHA7_i001):p.(Glu501Aspfs*96) * Thus p.E501Dfs *</P> */ @Test public void testFSDeletionVar10() throws AnnotationException, JannovarException { byte chr = 5; int pos = 140215471; String ref = "GCGCG"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("PCDHA7(uc003lhq.2:exon1:c.1503_1507del:p.E501Dfs,uc011dac.2:exon1:c.1503_1507del:p.E501Dfs)",annot); } } /** *<P> * annovar: PCDHB18:uc003ljc.1:exon1:c.1219_1221del:p.407_407del, * chr5:140615504GTC>- *</P> */ @Test public void testFSDeletionVar11() throws AnnotationException , JannovarException { byte chr = 5; int pos = 140615504; String ref = "GTC"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("PCDHB18(uc003ljc.1:exon1:c.1219_1221del:p.407_407del)",annot); } } /** *<P> * annovar: OR2B2:uc011dkw.2:exon1:c.985delA:p.T329fs, * chr6:27879113T>- *</P> */ @Test public void testFSDeletionVar12() throws AnnotationException, JannovarException { byte chr = 6; int pos = 27879113; String ref = "T"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("OR2B2(uc011dkw.2:exon1:c.985delA:p.T329fs)",annot); } } /** *<P> * annovar: KCNK17:uc003ooo.3:exon2:c.318_320del:p.106_107del,KCNK17:uc003oop.3:exon2:c.318_320del:p.106_107del, * chr6:39278701AAG>- *</P> */ @Test public void testFSDeletionVar13() throws AnnotationException, JannovarException { byte chr = 6; int pos = 39278701; String ref = "AAG"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("KCNK17(uc003ooo.3:exon2:c.318_320del:p.106_107del,uc003oop.3:exon2:c.318_320del:p.106_107del)",annot); } } /** *<P> * annovar: KIAA2026:uc010mht.3:exon4:c.1539_1541del:p.513_514del,KIAA2026:uc003zjq.4:exon8:c.4014_4016del:p.1338_1339del, * chr9:5921980GTT>- *</P> */ @Test public void testFSDeletionVar14() throws AnnotationException , JannovarException { byte chr = 9; int pos = 5921980; String ref = "GTT"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("KIAA2026(uc010mht.3:exon4:c.1539_1541del:p.513_514del,uc003zjq.4:exon8:c.4014_4016del:p.1338_1339del)",annot); } } /** *<P> * annovar: AGAP6:uc001jix.4:exon8:c.791_792del:p.264_264del, * chr10:51768676AA>- * NM_001077665.2:c.791_792del * Mutalyzer: * NM_001077665.2(AGAP6_v001):c.791_792del * NM_001077665.2(AGAP6_i001):p.(Lys264Argfs*10) * Thus p.K264Rfs *</P> */ @Test public void testFSDeletionVar16() throws AnnotationException , JannovarException { byte chr = 10; int pos = 51768676; String ref = "AA"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("AGAP6(uc001jix.4:exon8:c.791_792del:p.K264Rfs)",annot); } } /** *<P> * annovar: AGAP6:uc001jix.4:exon8:c.890_892del:p.297_298del, * chr10:51768775TGA>- *</P> */ @Test public void testFSDeletionVar17() throws AnnotationException , JannovarException { byte chr = 10; int pos = 51768775; String ref = "TGA"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("AGAP6(uc001jix.4:exon8:c.890_892del:p.297_298del)",annot); } } /** *<P> * annovar: OR5M1:uc001nja.1:exon1:c.423_426del:p.141_142del, * chr11:56380553GACA>- * Thus NM_001004740:c.423_426del * Mutalzyer * NM_001004740(OR5M1_v001):c.429_432del * NM_001004740(OR5M1_i001):p.(Cys143Trpfs*19) * Thus p.C143Wfs *</P> */ @Test public void testFSDeletionVar18() throws AnnotationException , JannovarException { byte chr = 11; int pos = 56380553; String ref = "GACA"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("OR5M1(uc001nja.1:exon1:c.423_426del:p.C143Wfs)",annot); } } /** *<P> * annovar: FAM90A1:uc001quh.2:exon5:c.376delC:p.P126fs,FAM90A1:uc001qui.2:exon6:c.376delC:p.P126fs, * chr12:8376101G>- *</P> */ @Test public void testFSDeletionVar19() throws AnnotationException , JannovarException{ byte chr = 12; int pos = 8376101; String ref = "G"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("FAM90A1(uc001qui.2:exon6:c.376delC:p.P126fs,uc001quh.2:exon5:c.376delC:p.P126fs)",annot); } } /** *<P> * annovar: SETD8:uc001uew.3:exon5:c.542_543del:p.181_181del, * chr12:123880924TT>- * NM_020382:c.542_543del * Mutalyzer: * NM_020382(SETD8_v001):c.542_543del * NM_020382(SETD8_i001):p.(Leu181Hisfs*20) * THus p.L181Hfs *</P> */ @Test public void testFSDeletionVar21() throws AnnotationException , JannovarException{ byte chr = 12; int pos = 123880924; String ref = "TT"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("SETD8(uc001uew.3:exon5:c.542_543del:p.L181Hfs)",annot); } } /** *<P> * annovar: FAM194B:uc001vam.1:exon2:c.398_415del:p.133_139del,FAM194B:uc001val.2:exon3:c.398_415del:p.133_139del, * chr13:46170726ACTCTTCCTCCTCCAGAT>- * expected:<FAM194B(uc001va[m.1:exon2:c.398_415del:p.133_139del,uc001val.2:exon3]:c.398_415del:p.133_...> * but was:<FAM194B(uc001va[l.2:exon3:c.398_415del:p.133_139del,uc001vam.1:exon2]:c.398_415del:p.133_...> * (order changed) * expected:<FAM194B(uc001va[l.2:exon3:c.398_415del:p.133_139del,uc001vam.1:exon2]:c.398_415del:p.133_...> but was: * <FAM194B(uc001va[m.1:exon2:c.398_415del:p.133_139del,uc001val.2:exon3]:c.398_415del:p.133_...> *</P> */ @Test public void testFSDeletionVar22() throws AnnotationException , JannovarException{ byte chr = 13; int pos = 46170726; String ref = "ACTCTTCCTCCTCCAGAT"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("FAM194B(uc001val.2:exon3:c.398_415del:p.133_139del,uc001vam.1:exon2:c.398_415del:p.133_139del)",annot); } } /** *<P> * annovar: CCDC33:uc002axo.3:exon2:c.100_102del:p.34_34del, * chr15:74536404AAG>- *</P> */ @Test public void testFSDeletionVar23() throws AnnotationException , JannovarException { byte chr = 15; int pos = 74536404; String ref = "AAG"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("CCDC33(uc002axo.4:exon2:c.100_102del:p.34_34del)",annot); } } /** *<P> * annovar: CCDC33:uc002axo.3:exon2:c.100_102del:p.34_34del, * chr15:74536404AAG>- *</P> */ @Test public void testFSDeletionVar24() throws AnnotationException , JannovarException{ byte chr = 15; int pos = 74536404; String ref = "AAG"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("CCDC33(uc002axo.4:exon2:c.100_102del:p.34_34del)",annot); } } /** *<P> * annovar: LOC645752:uc010bky.2:exon14:c.832_834del:p.278_278del, * chr15:78208899CTC>- *</P> */ @Test public void testFSDeletionVar25() throws AnnotationException , JannovarException { byte chr = 15; int pos = 78208899; String ref = "CTC"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("LOC645752(uc010bky.2:exon14:c.832_834del:p.278_278del)",annot); } } /** *<P> * annovar: SENP3:uc002ghm.3:exon8:c.1307delA:p.K436fs, * chr17:7470288A>- *</P> */ @Test public void testFSDeletionVar26() throws AnnotationException, JannovarException { byte chr = 17; int pos = 7470288; String ref = "A"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("SENP3(uc002ghm.3:exon8:c.1307delA:p.K436fs)",annot); } } /** *<P> * annovar: ATAD5:uc002hfs.1:exon2:c.861_866del:p.287_289del,ATAD5:uc002hft.1:exon1:c.552_557del:p.184_186del, * chr17:29161960GTCAAT>- *</P> */ @Test public void testFSDeletionVar28() throws AnnotationException , JannovarException{ byte chr = 17; int pos = 29161960; String ref = "GTCAAT"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("ATAD5(uc002hft.1:exon1:c.552_557del:p.184_186del,uc002hfs.1:exon2:c.861_866del:p.287_289del)",annot); } } /** *<P> * annovar: DCAF7:uc002jbc.3:exon6:c.560delG:p.G187fs, * chr17:61660895G>- *</P> */ @Test public void testFSDeletionVar29() throws AnnotationException , JannovarException { byte chr = 17; int pos = 61660895; String ref = "G"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("DCAF7(uc002jbc.4:exon6:c.560delG:p.G187fs)",annot); } } /** *<P> * annovar: DEFB126:uc002wcx.3:exon2:c.317_318del:p.106_106del, * chr20:126314CC>- * Mutalzyer: * NM_030931(DEFB126_v001):c.317_318del * NM_030931(DEFB126_i001):p.(Pro106Argfs*27) * p.P106Rfs */ @Test public void testFSDeletionVar32() throws AnnotationException , JannovarException { byte chr = 20; int pos = 126314; String ref = "CC"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("DEFB126(uc002wcx.3:exon2:c.317_318del:p.P106Rfs)",annot); } } /** *<P> * annovar: PLAC4:uc002yyz.3:exon1:c.70_88del:p.24_30del, * chr21:42551468GTGTCAGGGTGAGTGAGGG>- * minus strand * Mutalyzer: * NM_182832(PLAC4_v001):c.72_90del * NM_182832(PLAC4_i001):p.(Ser25Hisfs*78) * Thus p.S25Hfs *</P> */ @Test public void testFSDeletionVar33() throws AnnotationException , JannovarException { byte chr = 21; int pos = 42551468; String ref = "GTGTCAGGGTGAGTGAGGG"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("PLAC4(uc002yyz.3:exon1:c.70_88del:p.S25Hfs)",annot); } } /** *<P> * annovar: ZNF135:uc010yhq.2:exon5:c.1992_1997del:p.664_666del,ZNF135:uc002qre.3:exon5:c.1956_1961del:p.652_654del,ZNF135:uc002qrg.3:exon4:c.2028_2033del:p.676_678del,ZNF135:uc002qrd.2:exon5:c.1152_1157del:p.384_386del,ZNF135:uc010yhr.2:exon3:c.1419_1424del:p.473_475del,ZNF135:uc002qrf.3:exon5:c.1830_1835del:p.610_612del, * chr19:58579808CCAGAG>- *</P> */ @Test public void testFSDeletionVar31() throws AnnotationException , JannovarException{ byte chr = 19; int pos = 58579808; String ref = "CCAGAG"; String alt = "-"; Chromosome c = chromosomeMap.get(chr); if (c==null) { Assert.fail("Could not identify chromosome \"" + chr + "\""); } else { AnnotationList ann =c.getAnnotationList(pos,ref,alt); VariantType varType = ann.getVariantType(); Assert.assertEquals(VariantType.NON_FS_DELETION,varType); String annot = ann.getVariantAnnotation(); Assert.assertEquals("ZNF135(uc002qrd.2:exon5:c.1152_1157del:p.384_386del,uc010yhr.2:exon3:c.1419_1424del:p.473_475del,uc002qrf.3:exon5:c.1830_1835del:p.610_612del,uc002qre.3:exon5:c.1956_1961del:p.652_654del,uc010yhq.2:exon5:c.1992_1997del:p.664_666del,uc002qrg.3:exon4:c.2028_2033del:p.676_678del)",annot); } } }